Skip to main content

Table 1 qPCR primers

From: Valproic acid decreases urothelial cancer cell proliferation and induces thrombospondin-1 expression

Target Gene Primer 1 Primer 2
ATP Synthase GGCAGGGTCAGTCAAGTCAT CCCTTCTGCTGTGGGCTAT
HSP 90 ATGCCTGAGGAAGTGCACCAT CCAGACTTGGCAATGGTTCCC
BAX TCAATATCAGGGAGCCCAAG AGCAGCACCTGAAGAAGGTC
Beta-Actin GTGGGCATGGGTCAGAAGGATTCC GGCCAGAGGCGTACAGGGATAG
TSP-1 ACTGTCCATTCCATTACAACCCAGC TGTCACACTGATCTCCAACCCCATCCA
HO-1 GGTGATAGAAGAGGCCAAGAC GCAGAATCTTGCACTTTGTTG