Skip to main content

Table 1 Sequence of primers used in qRT-PCR

From: microRNA-99a acts as a tumor suppressor and is down-regulated in bladder cancer

Primer Sequence(5′ → 3′)
miR-99a-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACAAGA
miR-99a-forward GCTGGAGAACCCGTAGATCCGAT
miR-99a-reverse GTGCAGGGTCCGAGGT
miR-99a-probe FAM-ATACGACCACAAGATCGG-MGB
U6-RT AAAATATGGAACGCTTCACGAATTTG
U6-forward CTCGCTTCGGCAGCACATATACT
U6-reverse ACGCTTCACGAATTTGCGTGTC
U6-probe FAM-CCATGCTAATCTTCTCTGTA-MGB