Skip to main content

Table 1 Primers for PKC isoforms expressed in the urinary bladder

From: Altered detrusor contractility and voiding patterns in mice lacking the mechanosensitive TREK-1 channel

Name Sequence Fragment Size (bp) Accession Number
PKCα-F AGGAGCCACAAGCAGTATTC 93 NM_011101.3
PKCα-R CCAGCTTCAGATCCCTGTAAAT   
PKCβ-F GCAGAGCAAGGGCATTATTTAC 114 NM_001316672.1
PKCβ-R CCATCCCAGATGTTCTCCTTAC   
PKCγ-F GCACCTGAGATCATTGCCTATC 90 NM_011102.4
PKCγ-R CTGTCCTGCCAACATCTCATAC   
PKCδ-F TAGTGAGGAGGAGGCAAAGT 105 NM_001310682.1
PKCδ-R CCGAAGAAGGTGGCGATAAA   
PKCε-F GCTCGGAAACACCCTTATCT 100 NM_001310682.1
PKCε-R ACATGAGGTCTCCACCATTTAC   
PKCμ-F GCAGTGGAGTTAGAAGGAGAAG 123 XM_006515590.3
PKCμ-R GGCTCACAGGAGACAGTAAAG   
PKCτ-F CAGGGACCTGAAGCTTGATAAT 96 NM_008859.2
PKCτ-R GCATCTCCTAGCATGTTCTCTT