Skip to main content

Table 2 Real-time qPCR primer sequences, amplification conditions and product length for reference genes

From: In vitro and in silico assessment of the effect of WWOX expression on invasiveness pathways associated with AP-2 transcription factors in bladder cancer

Gene Primer sequence Product
[bp]
Annealing
[°C]
Reading
[°C]
H3F3A 5′ACGGATTACACCTTCCCACTTGCTAAAAGGTC3′
5′AGCCACAAAGGCAGATGGATCAGCCAAG3′
69 65 72
RPLP0 5′AGGACTTTAAAAGATCTGCGCTTCCAGAG3′
5′ACCAGATAGGCCTCACTTGCCTCCTGC3′
76 65 72
RPS17 5′AAGCGCGTGTGCGAGGAGATCG3′
5′TCGCTTCATCAGATGCGTGACATAACCTG3′
87 64 72
\