Skip to main content

Table 3 Real-time qPCR primer sequences, amplification conditions and product length for target genes

From: In vitro and in silico assessment of the effect of WWOX expression on invasiveness pathways associated with AP-2 transcription factors in bladder cancer

Gene Primer sequence Product
[bp]
Annealing
[°C]
Reading
[°C]
ACVR1B 5′CTGACCCTTCCATTGAGGAAAT3′
5′CCGCAGTGCCTCATAACTC3′
95 60 60
CRABP2 5′CCTGTAAGAGCCTGGTGAAA3′
5′ATCGTTGGTCAGTTCTCTGG3′
110 60 60
CDKN1A 5′GACAGACAACTCACTCGTCAAA3′
5′CATGGCGCCTGAACAGAA3′
86 60 60
TP63 5′GAAACCAGAGATGGGCAAGT3′
5′ATGCTATCTTCATCCGCCTTC3′
95 60 60
AP1M2 5′AAGCCACTGATCTGGATTGAG3′
5′CCTTGGCCTTGACCATGA3′
76 60 60
IKBKB 5′CTGTATCCTTCAAGAGCCCAAG3′
5′CCGGTTGCAATCTTCCTTCA3′
106 60 60
SMAD4 5′ATGGATACGTGGACCCTTCT3′
5′ATGTGCAACCTTGCTCTCTC3′
97 60 60
\