Skip to main content

Table 1 Sequence-tagged sites and primer sequences for Y chromosome microdeletion analysis

From: Detection of AZF microdeletions and reproductive hormonal profile analysis of infertile sudanese men pursuing assisted reproductive approaches

Region STS   Sequence 5′– 3' Size bp References
Yp sY14 Forward GAATATTCCCGCTCTCCGGA 495 [9]
   Reverse GCTGGTGCTCCATTCTTGAG   
AZFa sY81 Forward AGGCACTGGTCAGAATGAAG 209 [8]
   Reverse AATGGAAAATACAGCTCCCC   
  sY84 Forward AGAAGGGTCTGAAAGCAGGT 326 [9]
   Reverse GCCTACTACCTGGAGGCTTC   
  sY86 Forward GTGACACACAGACTATGCTTC 320 [9]
   Reverse ACACACAGAGGGACAACCCT   
AZFb sY127 Forward GGCTCACAAACGAAAAGAAA 274 [9]
   Reverse CTGCAGGCAGTAATAAGGGA   
  sY128 Forward GGATGAGACATTTTTGTGGG 384 [10]
   Reverse AGCCCAATGTAAACTGGACA   
AZFc sY239 Forward CATTCATCTTCCCTTTTGAAGG 201 [8]
   Reverse ATGCAAGTCGCAGGAAATCT   
  sY254 Forward GGGTGTTACCAGAAGGCAAA 370 [9]
   Reverse GAACCGTATCTACCAAAGCAGC   
  sY255 Forward GTTACAGGATTCGGCGTGAT3 126 [9]
   Reverse CTCGTCATGTGCAGCCAC   
AZFd sY152 Forward AAGACAGTCTGCCATGTTTCA 125 [11]
   Reverse ACAGGAGGGTACTTAGCAGT   
  sY153 Forward GCATCCTCATTTTATGTCCA 139 [8]
   Reverse CAACCCAAAAGCACTGAGTA3